Skip to content

Repository files navigation

Latest Release

scNanoGPS: Single cell Nanopore sequencing analysis of Genotype and Phenotype Simultaneously

scNanoGPS is a computational toolkit for analyzing high throughput single cell nanopore sequencing data to detect Genotypes and Phenotype Simultaneously from same cells. scNanoGPS includes 5 major steps: 1) NanoQC to perform quality control of the raw seqeucning data; 2) Scanner to scan and filter out reads that do not have expected adapater sequence patterns, i.e., TrueSeq Read 1 adapter sequence, TSO adaper sequence, poly (A/T)n block sequence, Cell Barcodes (CB) and unique molecule identifier (UMI) sequence blocks; 3) Assigner to detect the list of true cell barcodes, merge cell barcodes with sequencing errors and assign raw reads into single cells; 4) Curator to detect reads with true UMIs and collapse them to make consensus sequences of individual molecules to curate sequencing errors on gene bodies; 5) Reporter to detect single cell transcriptomes, single cell gene isoforms and single cell mutations from consensus single cell long reads data.

Keywords

Single cell, Nanopore, RNA sequencing, long read, cell barcode demultiplex, UMI curation, gene expression, isoform, single nucleotide variation

Citing scNanoGPS

Shiau, CK., Lu, L., Kieser, R. et al. High throughput single cell long-read sequencing analyses of same-cell genotypes and phenotypes in human tumors. Nat Commun 14, 4124 (2023). https://doi.org/10.1038/s41467-023-39813-7

Update for scNanoGPS v2.0

  1. Scanner is now using biopython Align module and no longer popping up deprecated warnings.
  2. Assigner is now taking whitelist and is available for long-read spatial RNA-seq data.
  3. Curator efficiency is doubled.
  4. Isoform calling is now switching to IsoQuant.

Index

Installation

The scNanoGPS pipeline is built with python3. We recommend users to use anaconda/miniconda virtual environment to install it. Refer to Anaconda turorial for environment building.

Build python3 virtual environment

  • Example codes for creating and activating python3 environment on Linux-based OS:
    conda create -n scNanoGPS python=3 numpy scipy
    source activate scNanoGPS
    

Install scNanoGPS and dependencies

  • The scNanoGPS requires the following dependencies to work:

    - biopython 1.80
    - distance 0.1.3
    - matplotlib 3.8.2
    - pandas 2.1.4
    - pysam 0.19.0
    - seaborn 0.13.1
    
  • Example codes for obtaining scNanoGPS from GitHub and installation of dependencies:

    git clone https://github.com/gaolabtools/scNanoGPS/
    cd scNanoGPS
    pip3 install -r requirements.txt
    

Install other essential tools

scNanoGPS uses the following third party tools for mapping again genome reference, collapsing reads with same UMIs, and sumamrizing single cell gene expression, isoform, and SNV profiles.

  • Example codes for installation of third party tools
    • minimap2 (GitHub, Anaconda)
      conda install -c bioconda minimap2
      
    • Samtools (GitHub, Anaconda)
      conda install -c bioconda samtools
      
    • tabix (Anaconda)
      conda install -c bioconda tabix
      
    • SPOA (GitHub, Anaconda)
      conda install -c bioconda spoa
      
    • SubRead featureCounts (SourceForge, Anaconda)
      # You can download and unzip pre-compiled binary file from https://sourceforge.net/projects/subread/files/subread-2.0.3/
      
      tar -xzf subread-2.0.3-<platform>.tar.gz
      
      # or install subread via anaconda
      
      conda install -c bioconda subread
      
    • IsoQuant (GitHub)
      conda install -c conda-forge -c bioconda isoquant
      
    • Longshot (GitHub, Anaconda)
      conda install -c bioconda longshot
      
    • BCFtools (GitHub, Anaconda)
      conda install -c bioconda bcftools
      
    • ANNOVAR
      # You can download ANNOVAR from https://www.openbioinformatics.org/annovar/annovar_download_form.php
      
      tar -xvf annovar.latest.tar.gz
      
    • (optional) gffread (GitHub)
      git clone https://github.com/gpertea/gffread
      cd gffread
      make release
      
    • Qualimap (Anaconda)
      # You can download Qualimap from http://qualimap.conesalab.org/
      
      unzip qualimap_v2.2.1.zip
      
      # or install qualimap via anaconda
      
      conda install -c bioconda qualimap
      

Prepare reference genome and annotations

  • Reference genome
    Users can obtain reference genome from NCBI, Ensembl, or any other autorities

    wget https://ftp.ensembl.org/pub/release-100/fasta/homo_sapiens/dna/Homo_sapiens.GRCh38.dna.toplevel.fa.gz
    
  • Gene annotation (GTF/GFF)
    Users can obtain reference gene annotations from NCBI, Ensembl, or any other autorities

    wget https://ftp.ensembl.org/pub/release-100/gtf/homo_sapiens/Homo_sapiens.GRCh38.100.gtf.gz
    
    • Note: Many tools cannot use compressed GTF file. Please try to gunzip compress GTF.gz beforehand.
  • Index reference genome for minimap2
    Prepare indexed genome for minimap2 to boost mapping. Refer to the Minimap2 instruction.

    • Example code:
      minimap2 -x map-ont -d example/GRCh38_chr22.mmi example/GRCh38_chr22.fa.gz
      
  • Annotation tables for ANNOVAR
    This version of scNanoGPS uses ANNOVAR to annotate single cell SNVs results, please refer to ANNOVAR's webpage for more information.

    • Example codes:
    perl annotate_variation.pl -buildver hg38 -downdb -webfrom annovar refGene hg38db/
    perl annotate_variation.pl -buildver hg38 -downdb cytoBand hg38db/
    perl annotate_variation.pl -buildver hg38 -downdb -webfrom annovar gnomad30_genome hg38db/
    perl annotate_variation.pl -buildver hg38 -downdb -webfrom annovar avsnp150 hg38db/
    perl annotate_variation.pl -buildver hg38 -downdb -webfrom annovar dbnsfp42c hg38db/
    

Using scNanoGPS

Please use the wrapper script "run_scNanoGPS.py" for your convenience. Make sure to update the path inside the master script with any text editor you like, then run the script with the following command.

sh run_scNanoGPS.py
  • Manual of run_scNanoGPS.py
Usage: run_scNanoGPS.py [options]

Options:
  -h, --help            show this help message and exit
  -i FQ_F_NAME          * Required ! Input FastQ/Fast5 file name, or directory
                        containing multiple input files. Support
                        fastq/fq/fastq.gz/fq.gz/fast5 format.
  -d O_DIR              Output directory name. Default: scNanoGPS_res
  --tmp_dir=TMP_DIR     Temporary folder name. Default: tmp
  -p PROTOCOL           10x barcoding protocol. (3p / 5p / spatial) Default:
                        3p
  -t NCORES             Number of cores for program running. Default: 1
  --gtf=GTF             * Required ! GTF file for expression calling.
  --ref_genome=REF_GENOME
                        * Required ! File for reference genome.
  --idx_genome=IDX_GENOME
                        Path to the Minimap2 genome index. Program will use
                        reference genome if no Minimap2 genome index given.
                        Default: None
  --whitelist=WHITELIST
                        Path to the cell barcode whitelist. Default: None
  --exc_bed=EXC_BED     Exclude specific regions (BED) in file. Default: None
  --isoquant=ISOQUANT   Provide path to IsoQuant to conduct isoform calling.
                        Default: None
  --annovar=ANNOVAR     Provide directory path to ANNOVAR to conduct SNP
                        calling. Default: None
  --annovardb=ANNOVARDB
                        Name of ANNOVAR database. Default: hg38db
  --annovargv=ANNOVARGV
                        Version of ANNOVAR genome version. Default: hg38
  --annovarprot=ANNOVARPROT
                        Analysis protocol of ANNOVAR. Default: refGene,cytoBan
                        d,gnomad30_genome,avsnp150,dbnsfp42c,cosmic96_coding,c
                        osmic96_noncoding
  --annovarop=ANNOVAROP
                        Analysis operation of ANNOVAR. Default: gx,r,f,f,f,f,f
  --annovar_xref=ANNOVAR_XREF
                        Path to cross-reference genome of ANNOVAR. Default:
                        hg38db/omim/gene_xref.txt
  • Note: After running "run_scNanoGPS.py", a shell script "run_scNanoGPS.sh" will be generated. Please review "run_scNanoGPS.sh" and make proper modifications per your OS and environment.
    1. If you're using cluster management, like slurm, please include proper environment variables.
    2. If you're using workflow management system, like nextflow or snakemake, please re-wite the script per your environments.

Results of scNanoGPS:

By default, the matrices of gene expression, isoform, and SNV (single nucleotide variation) are under scNanoGPS_res. All the matrices are well formated in tabular form and are ready for secondary analyses. A summary report under scNanoGPS_res named "summary.txt" is ready for quick QA/QC check.

Step-by-Step running scNanoGPS:

If you prefer to run each components of scNanoGPS step-by-step, the following tutorial can walk you through all the components of scNanoGPS.

Step 1: NanoQC

Read length distribution

scNanoGPS contains a script named “read_length_profiler.py” to compute the raw read lengths of all reads. The script can either read through individual FastQ/Fast5 files or all FastQ/Fast5 files under a given folder. The raw read length histogram is drawn accordingly.

  • Manual of read_length_profiler.py

    python3 other_utils/read_length_profiler.py -h
    Usage: read_length_profiler.py [options]
    
    Options:
      -h, --help     show this help message and exit
      -i FQ_F_NAME   File or folder name of reads.
      -d O_DIR       Output directory name. Default: scNanoGPS_res
      -f FIG_NAME    Read length histogram file name. Default: read_length.png
      -o O_NAME      Read length file name. Default: read_length.tsv.gz
      --fig_w=FIG_W  Width of figure (inch). Default: 12
      --fig_h=FIG_H  Height of figure (inch). Default: 7
    
  • Example code:

    python3 other_utils/read_length_profiler.py -i example/fastq/
    

FastQC (optional)

Per the experimental design of read architecture, the TruSeq Read1, cell barcode (CB), unique molecular identifier (UMI), and polyA tail are expected to locate either in the first or the last 100 nucleotide range of each Nanopore read. Users can use FastQC to check the qualities of the first and last 100 nucleotides of individual Nanopore reads to draw the per-base quality score boxplot.

  • Manual of prepare_read_qc.py

    Usage: prepare_read_qc.py [options]
    
    Options:
      -h, --help    show this help message and exit
      -i FQ_F_NAME  File or folder name of reads.
      -d O_DIR      Output directory name. Default: scNanoGPS_res
      -l READ_LEN   Length of the extracted first and last read nucleotides.
                    Default: 100
      --o1=O1       First given length of reads. Default: first_tail.fastq.gz
      --o2=O2       Last given length of reads. Default: last_tail.fastq.gz
    
  • Example code:

    python3 other_utils/prepare_read_qc.py -i example/fastq/
    

You can run FastQC to check first_tail.fastq.gz and last_tail.fastq.gz for quality score distribution.

Step 2: Scanner

This step of scNanoGPS pipeline is executed by a python script called “scanner.py”. This script scans for both TruSeq Read1 and polyA tail of the reads. Scanning for other sequence modules are optional. To boost the scanning speed, we scan the first and last 100 nucleotides of reads to recognize TruSeq Read 1 and PolyA. Following by recognition, Scanner extracts CBs and UMIs which are neighbored by TruSeq Read 1 and Poly(A/T)n sequence blocks. Then the Scanner outputs two different files. One is a processed FastQ file holding the insert sequences without TruSeq Read 1, CB, and UMI sequences. The CBs of individual reads are moved to the read names as tags. The other file is table named, “barcode_list.tsv”, storing reads information including read names, CBs, UMIs, and others.

  • Manual of scanner.py

    python3 scanner.py -h
    Usage: scanner.py [options]
    
    Options:
      -h, --help            show this help message and exit
      -i FQ_F_NAME          * Required ! Input FastQ/Fast5 file name, or directory
                            containing multiple input files. Support
                            fastq/fq/fastq.gz/fq.gz/fast5 format.
      -o FQ_O_NAME          Output fastq file name. Could be either in .fastq or
                            .gz format.Default: processed.fastq.gz
      -d O_DIR              Output directory name. Must give a new directory name
                            to prevent accidental overwriting ! Default:
                            scNanoGPS_res
      -b BC_F_NAME          Output cell barcode list file. Default:
                            barcode_list.tsv.gz
      -t NCORES             Number of cores for program running. Default: 1
      --log=LOG_F_NAME      Program log file. This file stores program running
                            parameters and counting details. Default:
                            scanner.log.txt
      --a5=ADAPTOR_FIVE_P   Sequence of 5'-adaptor. Default:
                            AAGCAGTGGTATCAACGCAGAGTACAT
      --a3=ADAPTOR_THREE_P  Sequence of 3'-adaptor. Default:
                            CTACACGACGCTCTTCCGATCT
      --pT=POLYT            Reverse-complement sequence of polyA. Default:
                            TTTTTTTTTTTT
      --lCB=BC_LEN          Length of cell barcode. Default: 16
      --lUMI=UMI_LEN        Length of UMI. Default: 12
      --min_read_length=MIN_READ_LENGTH
                            Minimal read length. Default: 200
      --editing_distance=ALLOW_EDITING_DISTANCE
                            Editing distance for cell barcode detection. Default:
                            2
      --matching_threshold=MATCHING_PERCENTAGE
                            Matching threshold for alignment search. Default: 0.7
      --score_threshold=SCORING_THRESHOLD
                            Scoring threshold for alignment search. Default: 0.4
      --batching_no=BATCH_NO
                            Number of reads for batch processing. Default: 1000
      --scanning_region=SCAN_REGION
                            Region length for adaptor scanning. Default: 100
      --debug_mode=DEBUG_MODE
                            Debug mode switch. Default: False
      --penalty_matching=DP_MA
                            Dynamic programming matching penalty. Default: 2
      --penalty_mismatching=DP_MI
                            Dynamic programming mismatching penalty. Default: -3
      --penalty_gap_opening=DP_GO
                            Dynamic programming gap opening penalty. Default: -5
      --penalty_gap_extention=DP_GE
                            Dynamic programming gap extention penalty. Default: -2
    
  • Example code:

    python3 scanner.py -i example/fastq/ -t 2
    

Step 3: Assigner

This step of scNanoGPS pipeline is executed by a python script called “assigner.py”. This script is designed for CB collapsing and estimation of the optimal CB number without guidance of 10X short-read sequencing data or any CB whitelist. To estimate the number of optimal CB, we use edge detection strategy to find out the point where has dramatical signal dropping (Fig. 1b). The detailed method is that the assigner first calculates the supporting UMI number to every CB, and sorts the CB list by UMI number in decreasing order. Following by computing the partial derivatives (slopes) per CB in log10 scale, the medium number of slope changes in log10 scale are computed per 0.001 log10 tick. Then the maximal medium log10 slope change is selected, and where is the crude anchoring for following processes. To fathom the fully signal dropping point and include more useful CBs, we allow 10% more signal in log10 scale. Next, the script collapses CBs which have similar sequences. Previous study shows that the most accurate criterial for CB and UMI collapsing in Illumina samples are three and two Levenshtein Distance (LD), respectively. Here we use one LD to merge similar CB as Refinery Local Optimization. Then a list of representative CB having sufficient supporting read is generated. Alternatively, you can forcely assign cell barcode number by using "forced_no" parameter.

  • Manual of assigner.py

    python3 assigner.py -h
    Usage: assigner.py [options]
    
    Options:
      -h, --help            show this help message and exit
      -i INPUT              Cell barcode list file. Could be either in .tsv or
                            .tsv.gz format. Default: barcode_list.tsv.gz
      -o OUTPUT             Cell barcode counting file name. Default:
                            CB_counting.tsv.gz
      -d O_DIR              Output directory name. Default: scNanoGPS_res
      --tmp_dir=TMP_DIR     Temporary folder name. Default: tmp
      -t NCORES             Number of cores for program running. Default: 1
      --log=LOG_F_NAME      Log file name. Default: assigner.log.txt
      --lCB=BC_LEN          Length of cell barcode. Default: 16
      --CB_no_ext=CB_NO_EXT
                            Increasing CB number on log scale. Default: 0.1
      --CB_log10_dist_o=CB_LOG10_DIST_O
                            File name used for plotting log10 UMI number
                            distribution. Default: CB_log10_dist.png
      --CB_mrg_thr=CB_MRG_THR
                            Threshold of distance for merging cell barcodes.
                            Default: 1
      --CB_mrg_dist=CB_MRG_DIST
                            File name for distance matrix of merging cell
                            barcodes. Default: CB_merged_dist.tsv.gz
      --CB_mrg_o=CB_MRG_O   File name for merged cell barcodes. Default:
                            CB_merged_list.tsv.gz
      --forced_no=FORCED_NO
                            Assign cell number in force. If this parameter is
                            assigned, the raw CB with given number will be
                            outputed without correction. Default: 0
      --min_cellno=MIN_CELLNO
                            Minimal cell number. Default: 1
      --smooth_res=SMOOTH_RES
                            Smoothening resolution on log10 scale. Default: 0.001
      --min_read_no=MIN_READ_NO
                            Minimal read number per cell. Default: 500
      --whitelist=WHITELIST
                            Barcode whitelist file. Default: None
    
  • Example code:

    python3 assigner.py -t 2
    
    # To generate raw matrix similar to 10X for SoupX, you can try forcedly assign cell number to 20000
    python3 assigner.py -t 2 --forced_no 20000
    

Step 4: Curator

This step of scNanoGPS pipeline is executed by a python script called “curator.py”. This script is used for demultiplexing, filtering, reference genome mapping and re-mapping, and UMI collapsing.

The master FastQ file of all cells is demultiplexed according to the true CB list determined by Assigner into single cell FastQ files each representing one cell. Curator then maps individual FastQ files onto given reference genome by Mimimap2 under splice mode. Chimeric reads from different chromosomes are filtered out in this step (fusion gene detection functionality is under development). Next, Curator scans UMIs through their full length reads by their mapped genomic orders. UMIs that within 2 LD and mapping to same genomic coordinates are considered as same UMI barcodes. To further accommodate possible small indels (<5bp) that causes minor drifting of mapping coordinates, Curator allows 5bp differences to buffer these sequencing errors. To perform parallel computing, the reads scanning is placed into batches based on their genomic coordinates. The reads that share same UMIs are collapsed to generate consensus sequences of individual molecules using software, SPOA. Finally, we re-map the consensus sequences of single cells onto reference genome by using Minimap2 under splice mode. There is a portion of reads that are singletons having only one UMI, which is mapped previsouly. We merged both singleton BAMs with consensus BAMs to formal a final BAMs as curated data.

  • Manual of curator.py

    python3 curator.py -h 
    Usage: curator.py [options]
    
    Options:
      -h, --help            show this help message and exit
      --fq_name=FQ_NAME     Processed fastq file name. Default: processed.fastq.gz
      -b BC_LIST            Output cell barcode list file. Default:
                            barcode_list.tsv.gz
      --CB_count=CB_COUNT   Cell barcode counting file name. Default:
                            CB_counting.tsv.gz
      --CB_list=CB_LIST     File name for merged cell barcodes. Default:
                            CB_merged_list.tsv.gz
      --ref_genome=REF_GENOME
                            * Required ! File for reference genome.
      --idx_genome=IDX_GENOME
                            Path to the Minimap2 genome index. Program will use
                            reference genome if no Minimap2 genome index given.
                            Default: None
      -d O_DIR              Output directory name. Default: scNanoGPS_res
      --tmp_dir=TMP_DIR     Temporary folder name. Default: tmp
      -t NCORES             Number of cores for computing. Default: 1
      --log=LOG_F_NAME      Log file name. Default: curator.log.txt
      --umi_ld=UMI_LD       Levenshtein distance for merging UMI. Default: 1
      --keep_meta=KEEP_META
                            Set it to 1 to keep meta data, e.g. sam files, for futher checking.
                            Default: None
      --inc_contig=INC_CONTIG
                            Set it to 1 to include non-autosome, i.e. contig or
                            scaffold. Currently the autosome is starting with
                            "chr" string. Default: None
      --inc_bed=INC_BED     Include specific regions (BED) in file. Default: None
      --exc_bed=EXC_BED     Exclude specific regions (BED) in file. Default: None
      --softclipping_thr=SOFTCLIPPING_THR
                            Threshold for softclipping. Default: 0.8
      --max_umi_duplicates=MAX_UMI_DUPLICATES
                            Maximal duplicates in UMI collapsing. Default: 500
      --minimap2=MINIMAP2   Path to minimap2. Default: minimap2
      --samtools=SAMTOOLS   Path to samtools. Default: samtools
      --spoa=SPOA           Path to spoa. Default: spoa
      --skip_curation=SKIP_CURATION
                            Set to 1 to skip UMI collaping and consensus sequence
                            generating. Default: None
    
  • Example code:

    python3 curator.py -t 2 --ref_genome example/GRCh38_chr22.fa.gz --idx_genome example/GRCh38_chr22.mmi
    
    # To generate raw matrix similar to 10X for SoupX, you can generate data by skipping curation
    python3 curator.py -t 2 --ref_genome example/GRCh38_chr22.fa.gz --idx_genome example/GRCh38_chr22.mmi --skip_curation 1
    

Step 5: Reporter

Lastly, scNanoGPS contains a set of reporter scripts for generating multi-omics profiles from same single cells with Nanopore long-read sequencing data. This version of scNanoGPS detects the gene expression, isoform, and single nucleotide variations (SNVs) profiles by using FeatureCounts, IsoQuant, and longshot, respectively.

5.1 Single cell gene expression profile

  • Manual of reporter_expression.py

    python3 reporter_expression.py -h
    Usage: reporter_expression.py [options]
    
    Options:
      -h, --help            show this help message and exit
      -d O_DIR              Output directory name. Default: scNanoGPS_res
      --tmp_dir=TMP_DIR     Temporary folder name. Default: tmp
      --gtf=GTF             * Required ! GTF file for expression calling.
      -o O_NAME             Counting table name. Default: matrix.tsv
      --log=LOG_F_NAME      Log file name.Default:
                            logs/reporter_expression.log.txt
      -t NCORES             Number of cores for program running. Default: 1
      --min_gene_no=MIN_GENE_NO
                            Minimal number of gene per cell. Default: 300
      --sel_bc_o=SEL_BC_O   Filtered cell barcode list. Default:
                            filtered_barcode_list.txt
      --keep_meta=KEEP_META
                            Keep meta files. Set to 1 to keep meta files.Default:
                            None
      --featurecounts=FEATURECOUNTS
                            Path to featureCounts.Default: featureCounts
    
  • Example code:

    # Please add featureCounts into your path to use which command
    
    python3 reporter_expression.py -t 2 --gtf example/GRCh38_chr22.gtf
    
    # or
    
    python3 reporter_expression.py -t 2 --gtf example/GRCh38_chr22.gtf --featurecounts /path/to/subread_folder/bin/featureCounts
    
    # Please add "min_gene_no 1" for test because the example fastq is a subset pool and contains only a dozen of genes. 
    
    python3 reporter_expression.py -t 2 --gtf example/GRCh38_chr22.gtf --min_gene_no 1 --featurecounts $(which featureCounts)
    

5.2 Single cell isoform profile

  • Manual of reporter_isoform.py

    python3 reporter_isoform.py -h
    Usage: reporter_isoform.py [options]
    
    Options:
      -h, --help            show this help message and exit
      -d O_DIR              Output directory name. Default: scNanoGPS_res
      --tmp_dir=TMP_DIR     Temporary folder name. Default: tmp
      --CB_file=CB_FILE     File name for filtered barcode list. Default:
                            filtered_barcode_list.txt
      --ref_genome=REF_GENOME
                            * Required ! File for reference genome.
      --gtf=GTF             * Required ! File for genome annotation.
      --bam_suf=BAM_SUF     Suffix of the bam files. Default:
                            .curated.minimap2.bam
      -o O_NAME             Counting table name. Default:
                            isoform_exp_matrix.tsv.gz
      --log=LOG_F_NAME      Log file name. Default: logs/reporter_isoform.log.txt
      -t NCORES             Number of cores for program running. Default: 1
      --batch_no=BATCH_NO   Batch number for merging bam files. Default: 500
      --samtools=SAMTOOLS   Path to samtools. Default: samtools
      --isoquant=ISOQUANT   Program name of IsoQuant. Default: isoquant.py
      --isoquant_d=ISOQUANT_D
                            IsoQuant output directory. Default:
                            scNanoGPS_res/IsoQuant_res
      --isoquant_o=ISOQUANT_O
                            Suffix of IsoQuant output file. Default:
                            OUT/OUT.transcript_model_grouped_counts.tsv
    
  • Example code:

    # Please specify path to IsoQuant python script
    
    python3 reporter_isoform.py -t 2 --ref_genome example/GRCh38_chr22.fa.gz --gtf example/GRCh38_chr22.gtf --isoquant <Path/to/isoquant.py>
    
    

5.3 single cell SNV profile

  • Manual of reporter_SNV.py

    python3 reporter_SNV.py -h
    Usage: reporter_SNV.py [options]
    
    Options:
      -h, --help            show this help message and exit
      -d O_DIR              Output directory name. Default: scNanoGPS_res
      --tmp_dir=TMP_DIR     Temporary folder name. Default: tmp
      --CB_file=CB_FILE     File name for filtered barcode list. Default:
                            filtered_barcode_list.txt
      --ref_genome=REF_GENOME
                            * Required ! File for reference genome.
      --longshot_min_cov=LONGSHOT_MIN_COV
                            Minimal coverage for longshot. Default: 2
      --longshot_min_alt_count=LONGSHOT_MIN_ALT_COUNT
                            Minimal alternative count for longshot. Default: 2
      --longshot_o=LONGSHOT_O
                            Prefix of LongShot output VCF file. Default:
                            longshot.output
      -o O_NAME             Result SNV matrix file name. Must be ended with
                            .vcf.gz. Default: matrix_SNV.vcf.gz
      --log=LOG_F_NAME      Log file name. Default: reporter_SNV.log.txt
      --o_snv_l=O_SNV_L     Filtered SNVs position list. Default:
                            filtered_SNV_position_list.tsv.gz
      --o_snv_dp=O_SNV_DP   SNVs depth matrix. Default: matrix_SNV_dp.tsv.gz
      -t NCORES             Number of cores for program running. Default: 1
      --samtools=SAMTOOLS   Path to samtools. Default: samtools
      --bcftools=BCFTOOLS   Path to bcftools. Default: bcftools
      --tabix=TABIX         Path to tabix. Default: tabix
      --longshot=LONGSHOT   Path to longshot. Default: None
      --prevalence=PREVALENCE
                            SNV prevalence rate. Default: 0.01
      --min_read_quality=MIN_READ_QUALITY
                            Minimal read quality. Default: 0
      --annovar=ANNOVAR     Path to Annovar. Default: None
      --annovar_db=ANNOVAR_DB
                            Path to Annovar database. Default: None
      --annovar_gv=ANNOVAR_GV
                            Annovar database genome version. Default: hg38
      --annovar_protocol=ANNOVAR_PROTOCOL
                            Protocols of Annovar database. Default:
                            refGene,cytoBand,gnomad30_genome,avsnp150,dbnsfp42c
      --annovar_operation=ANNOVAR_OPERATION
                            Operation of Annovar database. Default: gx,r,f,f,f
      --annovar_xref=ANNOVAR_XREF
                            Path to Omim xref. Default: None
      --keep_meta=KEEP_META
                            Keep meta files. Default: None
    
  • Example code for variant detection with LongShot and annotation with ANNOVAR (please make sure to include ANNOVAR in your path):

    # Please add annovar into your path to use which command
    
    python3 reporter_SNV.py -t 2 --ref_genome example/GRCh38_chr22.fa.gz --annovar $(which table_annovar.pl) --annovar_db path/to/annovar_db/
    
    # or
    
    python3 reporter_SNV.py -t 2 --ref_genome example/GRCh38_chr22.fa.gz --annovar /path/to/annovar/table_annovar.pl --annovar_db path/to/annovar_db/
    
  • Example code for variant calling without ANNOVAR annotations (optional, not suggested):

    python3 reporter_SNV.py -t 2 --ref_genome example/GRCh38_chr22.fa.gz
    

5.4 Generate final summary table

  • Manual of reporter_summary.py

    python3 reporter_summary.py -h
    Usage: reporter_summary.py [options]
    
    Options:
      -h, --help            show this help message and exit
      -d O_DIR              Output directory name. Default: scNanoGPS_res
      --tmp_dir=TMP_DIR     Temporary folder name. Default: tmp
      --scanner_log=SCANNER_LOG
                            Scanner log file name. Default: scanner.log.txt
      --bc_f=BC_F           Cell barcode list file. Default: barcode_list.tsv.gz
      --read_len_f=READ_LEN_F
                            Scanner log file name. Default: read_length.tsv.gz
      --CB_file=CB_FILE     File name for filtered barcode list. Default:
                            filtered_barcode_list.txt
      --exp_tb=EXP_TB       Counting table name. Default: matrix.tsv.gz
      --mrg_bam=MRG_BAM     Merged bam file. Default: None
      --ref_genome=REF_GENOME
                            * Required ! File for reference genome.
      --gtf=GTF             * Required ! Genome annotation file GTF.
      --log=LOG_F_NAME      Log file name. Default: logs/summary.txt
      --samtools=SAMTOOLS   Path to samtools. Default: samtools
      --qualimap=QUALIMAP   Path to qualimap. Default: qualimap
      --qualimap_param=QUALIMAP_PARAM
                            Additional parameters to qualimap. For example:
                            --java-mem-size=4G
      --keep_meta=KEEP_META
                            Set it to 1 to keep meta data, e.g. sam files, for
                            futher checking. Default: None
    
  • Example code for generating final summary

    python3 reporter_summary.py --ref_genome example/GRCh38_chr22.fa.gz --gtf example/GRCh38_chr22.gtf
    
  • Example summary table

    Read yield:                  98349656
    Valid read number:           76630302
    Detecting rate:              77.92%
    
    Median read length:          921.0
    Mean read length:            1146.76
    Maximal read length:         190885
    Median read quality:         21.12
    Mean read quality:           20.47
    
    Cell number:                 3470
    Raw reads per cell:          28342.84
    UMI counts:                  27292859
    Mean UMI counts per cell:    7865.38
    Median UMI counts per cell:  5212.5
    
    Exonic:                      13.91%
    Intronic:                    70.2%
    Intergenic:                  15.89%
    

Releases

Packages

Used by

Contributors

Languages