Skip to content

Repository files navigation

chelae

Build Status license Version info Bioconda

A fast, accurate, multi-threaded toolkit for trimming and filtering short-read FASTQ data, written in Rust.

The name chelae is the plural of chela — the pincer-like claws of crustaceans — a nod to what this tool does to FASTQ reads.

Fulcrum Genomics

Visit us at Fulcrum Genomics to learn more about how we can power your Bioinformatics with chelae and beyond.

This README is user-facing documentation. Contributors working on chelae itself should see CONTRIBUTING.md for build conventions, the pre-push checks, and the release process.

Contents

Overview

chelae ships two subcommands:

  • chelae trim — short-read FASTQ trim and filter pipeline (see below).
  • chelae detect — identify the adapter sequence(s) present in a FASTQ. PE input discovers adapters via R1/R2 overlap; SE input scores reads against every built-in kit plus optional user candidates. Optional FASTA output is designed to feed straight back into chelae trim --adapter-fasta.

chelae trim performs common short-read preprocessing tasks in one pass, in the following order:

  1. Poly-G 3' trim (on by default)
  2. Adapter trimming — PE-overlap evidence mode, plus --kit, --adapter-sequence, and --adapter-fasta for SE or deep trimming
  3. Read-structure based hard-trim and UMI extraction (runs after adapter trim so tail-skip segments operate on the cleaned template)
  4. Optional poly-X 3' trim (--trim-polyx)
  5. Optional 5'→3' and/or 3'→5' sliding-window quality trim
  6. Length filter post-trimming (--filter-length MIN[:MAX])
  7. Optional N-base filter, mean-quality filter, and low-quality-fraction filter

Outputs are BGZF-compressed FASTQ plus a fastp-compatible JSON report suitable for MultiQC.

chelae uses paired-read overlap detection combined with adapter-sequence confirmation to rapidly and confidently identify adapter sequence in paired-end reads. This repository includes a benchmark suite in benchmark-pipeline/; chelae is the fastest tool tested across all experimental setups, while also providing the highest accuracy trimming. See the Performance section below.

chelae trim — examples

PE-overlap adapter detection is on by default; for best accuracy it is also recommended to supply your adapter sequences via --kit or --adapter-sequence.

Trim paired-end reads with Illumina's truseq adapters

chelae trim \
    -i sample.r1.fq.gz sample.r2.fq.gz \
    -o trimmed.r1.fq.gz trimmed.r2.fq.gz \
    --kit truseq

Add in a 3' quality trim with an 8bp sliding window at Q20

chelae trim \
    -i sample.r1.fq.gz sample.r2.fq.gz \
    -o trimmed.r1.fq.gz trimmed.r2.fq.gz \
    --kit truseq \
    --quality-trim-3p 8:20

Trim paired-end reads while extracting an 8bp UMI and dropping 4 fixed bases in R1

chelae trim \
    -i sample.r1.fq.gz sample.r2.fq.gz \
    -o trimmed.r1.fq.gz trimmed.r2.fq.gz \
    --kit truseq \
    --read-structures 8M4S+T +T

chelae trim — options

The tables below summarize every option accepted by chelae trim. For longer explanations (rationale, units, edge cases) run chelae trim --help.

Inputs, outputs, and runtime

Option Description Default
-i, --inputs <PATHS>... One (SE) or two (PE) FASTQ files; plain, gzip, or bgzf (auto-detected)
-o, --outputs <PATHS>... Output FASTQ path(s); count must match --inputs; always BGZF-compressed
-t, --threads <N> Number of threads to use 4
-c, --compression-level <1-12> BGZF compression level for output files 5
-m, --metrics <PATH> Optional path for the trimming metrics TSV; stdout summary is always emitted
-j, --json <PATH> Optional fastp-shape JSON report; consumed by MultiQC's fastp module unchanged

Read-structure (hard-trim + UMI extraction)

Option Description Default
-r, --read-structures <RS>... Optional read-structures per input; supports T (template), M (UMI → read name), S (skip); applied after adapter trim
--discard-unsupported-segments Treat B (sample barcode) and C (cellular barcode) segments as S (skip) instead of erroring off

Adapter trimming

Option Description Default
-k, --kit <NAME>... Built-in kit preset; repeatable. Known: truseq, nextera, small-rna, aviti, mgi (alias dnbseq), all
-a, --adapter-sequence <SEQ>... 3' adapter sequence(s); 1 for SE, 1 or 2 for PE (R1, R2); ACGT or IUPAC
-f, --adapter-fasta <PATH> FASTA of adapter sequences; best match is trimmed
--adapter-min-length <N> Minimum match length when searching the 3' end for an adapter sequence (SE mode; PE mode only for inserts < overlap-min-length) 6
--adapter-mismatch-rate <0..1> Max fraction of mismatches when matching adapter against the 3' end (default ≈ 1 mismatch / 8 bases) 0.125

Paired-end overlap detection

Option Description Default
--no-overlap-detection Disable PE-overlap trim-point detection (ignored for SE); rely on sequence matching alone on (PE)
--overlap-min-length <N> Minimum overlap (bp) required to declare R1/R2 overlap 30
--overlap-max-mismatch-rate <0..1> Max fraction of mismatches in the overlap probe window 0.10
--overlap-diagnostic-length <N> When evaluating PE overlap, only examine this many overlapping bases. Multiples of 16 ideal. 64
--expected-insert-size <BP> Hint for typical insert size; seeds the overlap candidate-walk order so the right overlap is found sooner
--insert-size-stats Emit a fastp-shape per-pair insert-size histogram under insert_size in the JSON (extends overlap probing to I > R configurations) off

Poly-G / poly-X trimming

Option Description Default
--trim-polyg <N> 3' poly-G trim minimum run length; pass 0 to disable 10
--trim-polyx [<N>] Enable 3' poly-X trim (A/C/T homopolymer tails, e.g. poly-A from RNA-seq) with the given minimum run length off

Quality trimming

Both quality-trim modes shorten the read at the 3' end — the -3p / -5p suffix indicates the scan direction, not the trim location. -3p is conservative (keeps everything up to the last good window from the 3' end); -5p is aggressive (cuts at the first bad window encountered from the 5' end).

Option Description Default
--quality-trim-3p [<W:Q>] Scan 3'→5'; trim trailing bases until a window of size W has mean quality ≥ Q (fastp --cut_tail) off (8:20)
--quality-trim-5p [<W:Q>] Scan 5'→3'; truncate at the first window of size W with mean quality < Q (fastp --cut_right) off (8:20)

Filters (applied after trimming; pair dropped if either mate fails)

Option Description Default
-l, --filter-length <MIN[:MAX]> Drop reads/pairs with post-trim length below MIN (or above MAX) 15
--filter-max-ns <N> Drop reads/pairs whose per-mate count of ambiguous (N) bases exceeds N off
--filter-mean-qual <Q> Drop reads/pairs whose post-trim mean Phred quality is below Q (runs last, after every trim stage) off
--filter-low-qual <Q:F> Drop reads/pairs where the fraction of bases below quality Q exceeds F (e.g. 15:0.4) off

chelae detect — examples

chelae detect samples reads from one or two FASTQ files and reports the adapter sequence(s) present. PE input discovers adapters via R1/R2 overlap (no kit knowledge required); SE input scores reads against every built-in kit plus any user-supplied candidate. Discovered/winning adapter sequences can be written as FASTA for direct re-use by chelae trim --adapter-fasta.

Discover the adapters in a paired-end library

chelae detect \
    -i sample.r1.fq.gz sample.r2.fq.gz \
    -o adapters.fa

Identify which built-in kit a single-end library is using

chelae detect -i sample.fq.gz

Score a single-end library against extra user-supplied candidates

chelae detect \
    -i sample.fq.gz \
    -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
    -f custom-adapters.fa

Detect adapters, then trim using the discovered FASTA

chelae detect -i r1.fq.gz r2.fq.gz -o adapters.fa
chelae trim -i r1.fq.gz r2.fq.gz -o t.r1.fq.gz t.r2.fq.gz --adapter-fasta adapters.fa

chelae detect — options

Most flags are PE- or SE-only; the help-text annotation in each row says which mode the flag applies to. Run chelae detect --help for the full rationale.

Option Description Default
-i, --inputs <PATHS>... One (SE) or two (PE) FASTQ files; plain, gzip, or bgzf (auto-detected)
-o, --output-fasta <PATH> Optional FASTA output of discovered/winning adapter(s); ready to feed back into chelae trim --adapter-fasta
-a, --adapter-sequence <SEQ>... (SE only) Extra adapter candidate(s) to score against, in addition to every built-in kit
-f, --adapter-fasta <PATH> (SE only) FASTA of extra adapter candidates; record names are preserved in the report
-n, --num-detections <N> Target number of usable detections before stopping. Higher = more confident composition estimate 5000
--max-reads <N> Hard cap on records scanned even if --num-detections isn't reached 1000000
--min-detections-for-report <N> Refuse to report if final detection count falls below this floor (avoids confident-looking tiny samples) 20
--min-fraction <0..1> Minimum share of detections an adapter must account for to be reported 0.05
--min-tail-length <N> Minimum length of adapter evidence (bp) per detection (PE post-template tail; SE matched alignment) 8
--overlap-min-length <N> (PE) Minimum overlap (bp) required for PE-overlap detection 30
--overlap-max-mismatch-rate <0..1> (PE) Max fraction of mismatches in the overlap probe 0.10
--overlap-diagnostic-length <N> (PE) Upper bound on the probe length per overlap-length candidate (bp) 64
--adapter-min-length <N> (SE) Minimum match length (bp) when scoring a candidate against a read's 3' end 10
--adapter-mismatch-rate <0..1> (SE) Max fraction of mismatches when matching a candidate against a read's 3' end 0.125
--trim-polyg <N> 3' poly-G trim min run length applied before the probe (cleans 2-color "no signal" tails); 0 disables 10
--trim-polyx <N> 3' poly-X (A/C/T) trim min run length applied before the probe (more aggressive than trim's 10); 0 disables 5
--quality-trim <W:Q> 3' cut-right quality trim applied before the probe; pass off/none/no to disable 4:20

Performance

A Snakemake pipeline in benchmark-pipeline/ runs chelae against eight other FASTQ trimmers on simulated short-read libraries spanning cfDNA, WGS at several insert sizes, exome, miRNA, and a high-error condition — scoring both runtime and adapter-trim accuracy against the simulator's ground-truth boundaries.

chelae is the fastest tool tested on every dataset, and posts the most accurate adapter trimming on the majority of them. The two tables below show, per dataset, the top three tools by wall-clock time (wgs config: adapter + quality + length filter) and the top three tools by adapter-trim exact-match rate (adapter_only config). Every dataset is ~2× human WGS worth of simulated reads (read counts vary with read length — roughly 21–84 M pairs/reads per dataset). All numbers are 8-thread median over 3 replicates on an EC2 c8id.2xlarge (Intel Xeon 6975P-C, Granite Rapids).

Tool name abbreviations used in the tables: ar = adapterremoval, tg = trim-galore, tg-rs = trim-galore-rs, tmatic = trimmomatic.

Runtime — top 3 fastest tools per dataset, wall seconds @ 8 threads

ID Layout Insert Err rate #1 #2 #3
1 2×150 150 ± 30 0.1–1% chelae 37.4 cutadapt 78.2 tg-rs 78.2
2 2×150 250 ± 40 0.1–1% chelae 41.9 tg-rs 48.4 cutadapt 68.0
3 2×150 350 ± 60 0.1–1% chelae 42.2 tg-rs 48.6 cutadapt 65.8
4 2×150 450 ± 80 0.1–1% chelae 42.0 tg-rs 49.2 cutadapt 65.7
5 2×250 450 ± 80 0.1–1% chelae 37.9 tg-rs 44.3 cutadapt 57.5
6 2×150 250 ± 60 1–5% chelae 20.3 tg-rs 32.9 fastp-nfcore 39.4
7 2×150 170 ± 30 0.1–1% chelae 39.9 tg-rs 60.3 cutadapt 71.2
8 2×76 140 ± 25 0.1–1% chelae 50.5 tg-rs 61.5 cutadapt 84.8
9 1×150 300 ± 80 0.1–1% chelae 42.8 cutadapt 68.8 tg-rs 72.3
10 1×150 120 ± 30 0.1–1% chelae 39.5 bbduk 67.9 fastp 77.0
11 1×76 30 ± 2 0.1–1% chelae 38.1 bbduk 43.3 fastp 61.2

chelae is #1 on every dataset, with the runner-up trailing by 15–95 %. The lead is widest on short-insert PE libraries where more trimming occurs and on the high error rate dataset.

Accuracy — top 3 by adapter-trim RMSE per dataset (lower is better)

We score adapter-trim accuracy as RMSE of the difference in trim point (in bases) vs. the simulator's ground truth, aggregated across reads. RMSE is used so as to penalize large under- and over-trim errors more than small ones under the premise that each additional base lost (or adapter base retained) in a read is more consequential than the last.

ID Layout Insert Err rate #1 #2 #3
1 2×150 150 ± 30 0.1–1% chelae 0.045 ar 0.079 fastp 0.169
2 2×150 250 ± 40 0.1–1% chelae 0.013 cutadapt 0.189 tg 0.189
3 2×150 350 ± 60 0.1–1% chelae 0.009 cutadapt 0.098 tg 0.098
4 2×150 450 ± 80 0.1–1% chelae 0.010 cutadapt 0.090 tg 0.090
5 2×250 450 ± 80 0.1–1% chelae 0.011 cutadapt 0.166 tg 0.166
6 2×150 250 ± 60 1–5% chelae 0.393 ar 0.482 cutadapt 1.310
7 2×150 170 ± 30 0.1–1% chelae 0.040 ar 0.139 fastp 0.207
8 2×76 140 ± 25 0.1–1% chelae 0.016 cutadapt 0.284 ar 0.312
9 1×150 300 ± 80 0.1–1% chelae 0.267 cutadapt 0.272 fastp 0.284
10 1×150 120 ± 30 0.1–1% fastp 0.652 chelae 0.803 cutadapt 0.964
11 1×76 30 ± 2 0.1–1% tmatic 0.024 chelae 0.062 fastp 0.062

chelae wins on every PE dataset and one SE dataset, and comes second on the other two SE cases. On SE datasets, most tools perform similarly where it is possible to configure key parameters the same (i.e. min match length and maximum allowed error rate).

Tool versions

All tools were at the latest version available on bioconda as of the benchmarking date (2026-05-06), with one deliberate exception: fastp-nfcore runs a second fastp environment pinned to the version nf-core/modules currently ships, so MultiQC-via-nf-core users can see what they would actually get downstream.

Tool Version tested
chelae 0.1.0
fastp 1.3.2
fastp-nfcore 1.1.0 (nf-core/modules pin)
cutadapt 5.2
trim-galore 0.6.11
trim-galore-rs 2.1.0 (Oxidized Edition)
trimmomatic 0.40
bbduk (bbmap) 39.81
adapterremoval 2.3.4

More detail, raw data, and reproduction

For per-dataset tables with every tool (not just the top 3) and additional metrics — RSS, user CPU, parallel efficiency, MAE, false-positive and false-negative counts, etc. — see benchmark-pipeline/RESULTS.md.

The full per-row source data (one row per (sample, trim_config, tool, threads, replicate)) lives in benchmark-pipeline/.benchmark-outputs/perf-20260508/results/{bench_summary,accuracy_summary}.tsv. See benchmark-pipeline/README.md for the reproduction recipe.

Installing

Install from bioconda

Using pixi, after adding the bioconda channel:

pixi add chelae

Or using your favorite conda client (conda, mamba, micromamba, …):

conda install -c bioconda chelae

Installing with cargo

To install with cargo you must first install rust. Which (on macOS and Linux) can be done with:

curl https://sh.rustup.rs -sSf | sh

Then, to install chelae run:

cargo install chelae

Building From Source

First, clone the git repo:

git clone https://github.com/fulcrumgenomics/chelae.git

If you do not already have rust development tools installed, install via rustup:

curl --proto '=https' --tlsv1.2 -sSf https://sh.rustup.rs | sh

Then build in release mode:

cd chelae
cargo build --release
./target/release/chelae --help

Build Targeting and Portability

x86_64 release binaries ship as a single cargo multivers launcher that embeds three CPU-specific builds and picks the best match at startup:

  • x86-64 — SSE2 baseline, runs on any 64-bit x86 CPU (2003+)
  • x86-64-v2 — SSE4.2 + POPCNT (2008+); captures nearly all of the historical "v3 wins 6%" codegen benefit
  • x86-64-v4 — AVX-512F/BW/CD/DQ/VL for Ice Lake / Sapphire Rapids / Granite Rapids / Zen 4+

The launcher is ~3.7 MB total and adds ~0.2 s of startup for decompression + memfd_create + exec. v3 is intentionally skipped — on chelae's workload v2 and v3 are within measurement noise, and v4 picks up what little additional win AVX-512 gives (~1% on our benchmarks).

aarch64 release binaries (Apple Silicon, AWS Graviton, GCP Axion, Azure Cobalt) are a single build with generic ARMv8-A / NEON baseline. Benchmarks showed Neoverse-specific tuning yields only ~1-2% over generic and cross-tuning penalty is near zero, so multivers isn't worth the complexity on aarch64.

For local development, cargo build --release uses target-cpu=native (see .cargo/config.toml) for fastest local runs.

About

Fast, highly accurate, read-trimming for NGS data.

Topics

Resources

Code of conduct

Contributing

Stars

12 stars

Watchers

1 watching

Forks

Releases

Contributors

Languages